Pedido rápido

Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero LOC101925857 Información de producto de clon de cDNA
    Tamaño de cDNA:333bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925857 with C terminal His tag.
    Sinónimo de gen:LOC101925857
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90833-ACG$325
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90833-ACR$325
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90833-ANG$325
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90833-ANR$325
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90833-CF$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90833-CH$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90833-CM$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90833-CY$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90833-NF$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90833-NH$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90833-NM$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90833-NY$295
    Cangrejero LOC101925857 clonación del ADN o clonación génica(Vector de expresión)CG90833-U$75
    Cangrejero LOC101925857 clonación del ADN o clonación génica(vector de clonación)CG90833-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: CG90833-CH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.