Pedido rápido

Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero LOC101926331 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001284865.1
    Tamaño de cDNA:513bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) hypothetical protein.
    Sinónimo de gen:LOC101926331
    Especie:Cynomolgus
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90754-ACG$325
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90754-ACR$325
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90754-ANG$325
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90754-ANR$325
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90754-CF$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90754-CH$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90754-CM$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90754-CY$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(Vector de expresión)CG90754-G$75
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90754-NF$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90754-NH$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90754-NM$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90754-NY$295
    Cangrejero LOC101926331 clonación del ADN o clonación génica(vector de clonación)CG90754-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: CG90754-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"