After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus LOC701810 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_001096089.1
Tamaño de cDNA:687bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
Sinónimo de gen:LOC701810
Especie:Rhesus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación) on other vectors
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90744-ACG$225
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90744-ACR$225
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90744-ANG$225
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90744-ANR$225
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90744-CF$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90744-CH$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90744-CM$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90744-CY$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(Vector de expresión)CG90744-G$75
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90744-NF$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90744-NH$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90744-NM$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90744-NY$195
Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonación del ADN o clonación génica(vector de clonación)CG90744-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90744-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"