After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus MAT2A Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005575421.1
Tamaño de cDNA:1188bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101865874.
Sinónimo de gen:MAT2A
Especie:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación) on other vectors
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90747-ACG$225
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90747-ACR$225
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90747-ANG$225
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90747-ANR$225
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90747-CF$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90747-CH$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90747-CM$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90747-CY$195
Cangrejero MAT2A clonación del ADN o clonación génica(Vector de expresión)CG90747-G$75
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90747-NF$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90747-NH$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90747-NM$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90747-NY$195
Cangrejero MAT2A clonación del ADN o clonación génica(vector de clonación)CG90747-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"