MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-HA tag

Cat: CG90403-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MVD/Diphosphomevalonate decarboxylase Reagents

CRO Services

Product recommended


All MVD/Diphosphomevalonate decarboxylase Reagents

MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1206 bp
Description
Full length Clone DNA of Rhesus mevalonate (diphospho) decarboxylase with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MVD/Diphosphomevalonate decarboxylase Background Information

Full Name
mevalonate (diphospho) decarboxylase

MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone in Cloning Vector, Rhesus CG90403-G
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, untagged CG90403-UT
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90403-ACG
MVD/Diphosphomevalonate decarboxylase Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90403-ACGLN
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90403-ANG
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90403-ACR
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90403-ANR
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90403-CF
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90403-NF
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, C-His tag CG90403-CH
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-His tag CG90403-NH
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, C-HA tag CG90403-CY
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, C-Myc tag CG90403-CM
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Rhesus, N-Myc tag CG90403-NM

MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone in Cloning Vector, Mouse MG51894-G
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, untagged MG51894-UT
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51894-ACG
MVD/Diphosphomevalonate decarboxylase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51894-ACGLN
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51894-ANG
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51894-ACR
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51894-ANR
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51894-CF
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51894-NF
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, C-His tag MG51894-CH
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, N-His tag MG51894-NH
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, C-HA tag MG51894-CY
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, N-HA tag MG51894-NY
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, C-Myc tag MG51894-CM
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Mouse, N-Myc tag MG51894-NM
MVD/Diphosphomevalonate decarboxylase qPCR Primer Pairs, Mouse MP201767

MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone in Cloning Vector, Human HG16887-G
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, untagged HG16887-UT
MVD/Diphosphomevalonate decarboxylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16887-ACGLN
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, C-GFPSpark® tag HG16887-ACG
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, N-GFPSpark® tag HG16887-ANG
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, C-OFPSpark® tag HG16887-ACR
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, N-OFPSpark® tag HG16887-ANR
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16887-CF
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16887-NF
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, C-His tag HG16887-CH
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, N-His tag HG16887-NH
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, C-HA tag HG16887-CY
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, N-HA tag HG16887-NY
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, C-Myc tag HG16887-CM
MVD/Diphosphomevalonate decarboxylase cDNA ORF Clone, Human, N-Myc tag HG16887-NM
info info
添加购物车成功! 添加购物车失败!