Pedido rápido

Cangrejero Opalin / TMEM10 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus OPALIN Información de producto de clon de cDNA
Tamaño de cDNA:426bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) oligodendrocytic myelin paranodal and inner loop protein with N terminal Myc tag.
Sinónimo de gen:OPALIN
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cangrejero Opalin / TMEM10 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Product nameProduct name

Opalin, or oligodendrocytic myelin paranodal and inner loop protein, is a transmembrane protein detected specifically in mammalian oligodendrocytes, and may play significant role in oligodendrocyte differentiation and myelination.Opalin has binding sites for Myt1 and cAMP-response element binding protein (CREB). Over-expression of Myt1, treatment of the cell with leukemia inhibitory factor (LIF), and cAMP analog (CREB activator) enhanced the expression of endogenous Opalin in Oli-neu cells and activated the oligodendrocyte enhancer. Thus LIF, cAMP signaling cascades and Myt1 may play significant roles in the differentiation of oligodendrocytes through their action on the Opalin oligodendrocyte enhancer. Enzymatic deglycosylation showed that myelin Opalin contained N- and O-glycans, and that the O-glycans, at least, had negatively charged sialic acids. Site-directed mutations at the glycan sites impaired the cell surface localization of Opalin. In addition to the somata and processes of oligodendrocytes, Opalin immunoreactivity was observed in myelinated axons in a spiral fashion, and was concentrated in the paranodal loop region. Immunogold electron microscopy demonstrated that Opalin was localized at particular sites in the paranodal loop membrane. These results suggest a role for highly sialylglycosylated Opalin in an intermembranous function of the myelin paranodal loops in the central nervous system.

  • Aruga J, et al. (2007) An oligodendrocyte enhancer in a phylogenetically conserved intron region of the mammalian myelin gene Opalin. J Neurochem. 102(5):1533-47.
  • Kippert A, et al. (2008) Identification of Tmem10/Opalin as a novel marker for oligodendrocytes using gene expression profiling. BMC Neurosci. 9:40.
  • Yoshikawa F, et al. (2008) Opalin, a transmembrane sialylglycoprotein located in the central nervous system myelin paranodal loop membrane. J Biol Chem. 83(30):20830-40.
  • Golan N, et al. (2008) Identification of Tmem10/Opalin as an oligodendrocyte enriched gene using expression profiling combined with genetic cell ablation. Glia. 56(11):1176-86.
  • Size / Price
    Catálogo: CG90667-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.