After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus PARN Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005591297.1
Tamaño de cDNA:1920bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) poly(A)-specific ribonuclease with N terminal Flag tag.
Sinónimo de gen:PARN
Especie:Cynomolgus
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90462-ACG$245
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90462-ACR$245
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90462-ANG$245
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90462-ANR$245
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90462-CF$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90462-CH$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90462-CM$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90462-CY$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(Vector de expresión)CG90462-G$75
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90462-NF$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90462-NH$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90462-NM$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90462-NY$215
Cangrejero PARN/poly(A)-specific ribonuclease clonación del ADN o clonación génica(vector de clonación)CG90462-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90462-NF
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"