Pedido rápido

Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero PFKM Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_005570698.1
    Tamaño de cDNA:2343bp
    Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) phosphofructokinase, muscle with C terminal Myc tag.
    Sinónimo de gen:PFKM
    Especie:Cynomolgus
    Vector:pCMV3-C-Myc
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90449-ACG$245
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90449-ACR$245
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90449-ANG$245
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90449-ANR$245
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90449-CF$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90449-CH$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90449-CM$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90449-CY$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(Vector de expresión)CG90449-G$75
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90449-NF$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90449-NH$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90449-NM$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90449-NY$215
    Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación)CG90449-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

    Size / Price
    Catálogo: CG90449-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"