Pedido rápido

Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus PFKM Información de producto de clon de cDNA
Tamaño de cDNA:2343bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) phosphofructokinase, muscle with N terminal Flag tag.
Sinónimo de gen:PFKM
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90449-ACG$245
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90449-ACR$245
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90449-ANG$245
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90449-ANR$245
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90449-CF$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90449-CH$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90449-CM$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90449-CY$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(Vector de expresión)CG90449-G$75
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90449-NF$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90449-NH$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90449-NM$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90449-NY$215
Cangrejero PFK1/PFKM clonación del ADN o clonación génica(vector de clonación)CG90449-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Size / Price
Catálogo: CG90449-NF
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.