Pedido rápido

Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Cangrejero PPP2R2D Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_001091312.2
    Tamaño de cDNA:867bp
    Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform-like.
    Sinónimo de gen:PPP2R2D
    Especie:Rhesus
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación) on other vectors
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90762-ACG$225
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90762-ACR$225
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90762-ANG$225
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90762-ANR$225
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90762-CF$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90762-CH$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90762-CM$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90762-CY$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(Vector de expresión)CG90762-G$75
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90762-NF$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90762-NH$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90762-NM$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90762-NY$195
    Rhesus PPP2R2D clonación del ADN o clonación génica(vector de clonación)CG90762-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: CG90762-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"