After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus RBBP4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001261038.1
Tamaño de cDNA:1278bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) retinoblastoma binding protein 4.
Sinónimo de gen:RBBP4
Especie:Rhesus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90743-ACG$225
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90743-ACR$225
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90743-ANG$225
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90743-ANR$225
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90743-CF$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90743-CH$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90743-CM$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90743-CY$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(Vector de expresión)CG90743-G$75
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90743-NF$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90743-NH$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90743-NM$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90743-NY$195
Rhesus RBBP4/RBAP48 clonación del ADN o clonación génica(vector de clonación)CG90743-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Histone-binding protein RBBP4, also known as Retinoblastoma-binding protein 4, Retinoblastoma-binding protein p48, Chromatin assembly factor 1 subunit C, Chromatin assembly factor I p48 subunit, Nucleosome-remodeling factor subunit RBAP48 and RBBP4, is a nucleus protein which belongs to the WD repeat RBAP46/RBAP48/MSI1 family. RBBP4 is a core histone-binding subunit that may target chromatin assembly factors, chromatin remodeling factors and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. RBBP4 is a component of several complexes which regulate chromatin metabolism. These include the chromatin assembly factor 1 (CAF-1) complex, which is required for chromatin assembly following DNA replication and DNA repair; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling and the NURF (nucleosome remodeling factor) complex.

One common myth is that age-related memory loss is an early indication of Alzheimer's disease. But researchers at the Columbia University Medical Center in New York City have found a specific protein, RbAp48, that they believe is responsible for age-related memory problems. What's more, by replenishing RbAp48 in the brains of mice, the researchers were able to undo existing age-related memory damage.

To find RbAp48, researchers focused on the hippocampus, the region of the brain where memories are formed. After studying eight healthy brains donated to science by people between the ages of 33 and 88, they found that RbAp48 was reduced by nearly 50 percent in the older brains. The researchers found that when they turned off RbAp48 in younger mice, they became more forgetful, while increasing RbAp48 in older mice restored memory. The mice were given memory tests that included object recognition and water maze problems.

Referencias
  • Rasmussen HH. et al.,1992, Electrophoresis 13:960-9.
  • Qian Y.-W. et al., 1993,  Nature 364:648-52.
  • Yarden R.I. et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 4983-8.
  • Ota T. et al., 2004, Nat. Genet. 36:40-45.
  • Gauci S. et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    Catálogo: CG90743-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"