After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus RPS4Y1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001265622.1
Tamaño de cDNA:792bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ribosomal protein S4, X-linked.
Sinónimo de gen:RPS4X
Especie:Rhesus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90740-ACG$225
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90740-ACR$225
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90740-ANG$225
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90740-ANR$225
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90740-CF$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90740-CH$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90740-CM$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90740-CY$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(Vector de expresión)CG90740-G$75
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90740-NF$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90740-NH$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90740-NM$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90740-NY$195
Rhesus RPS4Y1 clonación del ADN o clonación génica(vector de clonación)CG90740-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90740-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"