RRNAD1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Cat: CG90599-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RRNAD1 Reagents

CRO Services

Product recommended


All RRNAD1 Reagents

RRNAD1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Rhesus ribosomal RNA adenine dimethylase domain containing 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RRNAD1 Background Information

Full Name
ribosomal RNA adenine dimethylase domain containing 1

RRNAD1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RRNAD1 cDNA ORF Clone in Cloning Vector, Rhesus CG90599-G
RRNAD1 cDNA ORF Clone, Rhesus, untagged CG90599-UT
RRNAD1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90599-ACGLN
RRNAD1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90599-ACG
RRNAD1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90599-ACR
RRNAD1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90599-CF
RRNAD1 cDNA ORF Clone, Rhesus, C-His tag CG90599-CH
RRNAD1 cDNA ORF Clone, Rhesus, N-His tag CG90599-NH
RRNAD1 cDNA ORF Clone, Rhesus, C-HA tag CG90599-CY
RRNAD1 cDNA ORF Clone, Rhesus, N-HA tag CG90599-NY
RRNAD1 cDNA ORF Clone, Rhesus, C-Myc tag CG90599-CM
RRNAD1 cDNA ORF Clone, Rhesus, N-Myc tag CG90599-NM

RRNAD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RRNAD1 cDNA ORF Clone in Cloning Vector, Mouse MG52997-G
RRNAD1 cDNA ORF Clone, Mouse, untagged MG52997-UT
RRNAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52997-ACGLN
RRNAD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52997-ACG
RRNAD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52997-ANG
RRNAD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52997-ACR
RRNAD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52997-ANR
RRNAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52997-CF
RRNAD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52997-NF
RRNAD1 cDNA ORF Clone, Mouse, C-His tag MG52997-CH
RRNAD1 cDNA ORF Clone, Mouse, N-His tag MG52997-NH
RRNAD1 cDNA ORF Clone, Mouse, C-HA tag MG52997-CY
RRNAD1 cDNA ORF Clone, Mouse, N-HA tag MG52997-NY
RRNAD1 cDNA ORF Clone, Mouse, C-Myc tag MG52997-CM
RRNAD1 cDNA ORF Clone, Mouse, N-Myc tag MG52997-NM

RRNAD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RRNAD1 cDNA ORF Clone, Human, untagged HG26203-UT
info info
添加购物车成功! 添加购物车失败!