After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rhesus CD62L/L-Selectin clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus SELL Información de producto de clon de cDNA
Tamaño de cDNA:1119bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) selectin L with C terminal Flag tag.
Sinónimo de gen:SELL
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rhesus CD62L/L-Selectin clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Product nameProduct name

L-selectin (SELL), also known as CD62L, is a key adhesion molecule that regulates both the migration of leukocytes at sites of inflammation and the recirculation of lymphocytes between blood and lymphoid tissues. It belongs to the selectin family of proteins, and consisting of a large, highly glycosylated, extracellular domain, a single spanning transmembrane domain and a small cytoplasmic tail. L-selectin is the only selectin expressed on leukocytes and mediates a number of leukocyte-endothelial interactions. L-selectin acts as a "homing receptor" for leukocytes to enter secondary lymphoid tissues via high endothelial venules. Ligands present on endothelial cells will bind to leukocyte expressing L-selectin, slowing leukocyte trafficking through the blood, and facilitating entry into a secondary lymphoid organ at that point. L-selectin-mediated lymphocyte recirculation is required for maintaining the appropriate tissue distribution of lymphocyte subpopulations including naïve and effector subsets such as regulatory T cells. In addition, L-selectin-mediated entry into peripheral lymph nodes is required for optimal induction of lymphocyte homeostatic proliferation during lymphopenia. Importantly, L-selectin has been shown to have both adhesive and signaling functions during leukocyte migration. L-selectin has also been shown to mediate leukocyte recruitment during chronic inflammatory and autoimmune diseases and thus is a potential therapeutic target for drug development.

  • Smalley DM, et al. (2005) L-selectin: mechanisms and physiological significance of ectodomain cleavage. J Cell Mol Med. 9(2): 255-66.
  • Grailer JJ, et al. (2009) L-selectin: role in regulating homeostasis and cutaneous inflammation. J Dermatol Sci. 56(3): 141-7.
  • Size / Price
    Catálogo: CG90168-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.