Pedido rápido

Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cangrejero SLC25A3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001257587.1
Tamaño de cDNA:1086bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3.
Sinónimo de gen:SLC25A3
Especie:Rhesus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90738-ACG$225
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90738-ACR$225
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90738-ANG$225
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90738-ANR$225
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90738-CF$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90738-CH$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90738-CM$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90738-CY$195
Rhesus SLC25A3 clonación del ADN o clonación génica(Vector de expresión)CG90738-G$75
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90738-NF$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90738-NH$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90738-NM$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90738-NY$195
Rhesus SLC25A3 clonación del ADN o clonación génica(vector de clonación)CG90738-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90738-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"