Pedido rápido

Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus SLC25A5 Información de producto de clon de cDNA
Tamaño de cDNA:897bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 with C terminal His tag.
Sinónimo de gen:SLC25A5
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90815-ACG$225
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90815-ACR$225
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90815-ANG$225
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90815-ANR$225
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90815-CF$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90815-CH$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90815-CM$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90815-CY$195
Rhesus SLC25A5 clonación del ADN o clonación génica(Vector de expresión)CG90815-G$75
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90815-NF$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90815-NH$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90815-NM$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90815-NY$195
Rhesus SLC25A5 clonación del ADN o clonación génica(vector de clonación)CG90815-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.