After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus SNRNP27 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001194069.1
Tamaño de cDNA:468bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) small nuclear ribonucleoprotein 27kDa (U4/U6.U5).
Sinónimo de gen:SNRNP27
Especie:Rhesus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90755-ACG$225
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90755-ACR$225
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90755-ANG$225
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90755-ANR$225
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90755-CF$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90755-CH$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90755-CM$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90755-CY$195
Rhesus SNRNP27 clonación del ADN o clonación génica(Vector de expresión)CG90755-G$75
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90755-NF$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90755-NH$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90755-NM$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90755-NY$195
Rhesus SNRNP27 clonación del ADN o clonación génica(vector de clonación)CG90755-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90755-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"