Pedido rápido

Text Size:AAA

Rhesus TGFBR2 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus TGFBR2 Información de producto de clon de cDNA
Tamaño de cDNA:1704bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transforming growth factor, beta receptor II (70/80kDa) with C terminal Myc tag.
Sinónimo de gen:TGFBR2
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

TGFBR2 is member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. It is a transmembrane protein. TGFBR2 is comprised by a C-terminal protein kinase domain and an N-terminal ectodomain. The ectodomain consists of a compact fold containing nine beta-strands and a single helix stabilised by a network of six intra strand disulphide bonds. The folding topology includes a central five-stranded antiparallel beta-sheet, eight-residues long at its centre, covered by a second layer consisting of two segments of two-stranded antiparallel beta-sheets. TGFBR2 has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in TGFBR2 gene have been associated with Marfan syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. TGFBR2 attenuates the biological activities of TGF-beta in colorectal cancer. TGFBR2 expression is increased in oral squamous cell carcinoma cells. Its expression is decreased by IL-1beta while inducing Sp3 via NFkappaB. TGFB2 and TGFBR2 are involved in the antiestrogenic activity.

  • Yu Y, et al. (2012) MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFβR2) in colon cancer cells. Carcinogenesis. 33(1):68-76.
  • Shima K, et al. (2011) TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS One. 6(9):e25062.
  • Biros E, et al. (2011) Meta-analysis of the association between single nucleotide polymorphisms in TGF-β receptor genes and abdominal aortic aneurysm. Atherosclerosis. 219(1):218-23.
  • Size / Price
    Catálogo: CG90063-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.