TLR9 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Price:
Size:
Number:

TLR9 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
3099 bp
Description
Full length Clone DNA of Rhesus toll-like receptor 9 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TLR9 Background Information

Toll-like receptors (TLRs) are important sensors that recognize pathogen-associated molecular patterns. Generally, TLR9 is known to recognize bacterial or viral DNA but not viral RNA and initiate an immune response. The significance of TLR9 in DENV-induced immune response is also confirmed in examination with the bone marrow-derived DCs prepared from Tlr9-knockout mice. As renal tubular epithelial TLR9 promotes cell injury and death whereas TLR9 signaling in other cell types may promote cytoprotective effects. TLR9 agonist delivered by inhalation is able to prime T cell responses against poorly immunogenic lung tumors and to complement the effects of PD-1 blockade.
Full Name
toll like receptor 9
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait