TRIM21 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90387-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All TRIM21 Reagents

CRO Services

Product recommended


All TRIM21 Reagents

TRIM21 cDNA ORF Clone, Rhesus, C-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Rhesus tripartite motif containing 21 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRIM21 Background Information

Full Name
tripartite motif containing 21

TRIM21 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TRIM21 cDNA ORF Clone in Cloning Vector, Rhesus CG90387-G
TRIM21 cDNA ORF Clone, Rhesus, untagged CG90387-UT
TRIM21 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90387-ACGLN
TRIM21 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90387-ACG
TRIM21 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90387-ANG
TRIM21 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90387-ACR
TRIM21 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90387-ANR
TRIM21 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90387-CF
TRIM21 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90387-NF
TRIM21 cDNA ORF Clone, Rhesus, C-His tag CG90387-CH
TRIM21 cDNA ORF Clone, Rhesus, N-His tag CG90387-NH
TRIM21 cDNA ORF Clone, Rhesus, N-HA tag CG90387-NY
TRIM21 cDNA ORF Clone, Rhesus, C-Myc tag CG90387-CM
TRIM21 cDNA ORF Clone, Rhesus, N-Myc tag CG90387-NM

TRIM21 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TRIM21 cDNA ORF Clone in Cloning Vector, Human HG18010-G
TRIM21 cDNA ORF Clone, Human, untagged HG18010-UT
TRIM21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18010-ACGLN
TRIM21 cDNA ORF Clone, Human, C-GFPSpark® tag HG18010-ACG
TRIM21 cDNA ORF Clone, Human, N-GFPSpark® tag HG18010-ANG
TRIM21 cDNA ORF Clone, Human, C-OFPSpark® tag HG18010-ACR
TRIM21 cDNA ORF Clone, Human, N-OFPSpark® tag HG18010-ANR
TRIM21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18010-CF
TRIM21 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18010-NF
TRIM21 cDNA ORF Clone, Human, C-His tag HG18010-CH
TRIM21 cDNA ORF Clone, Human, N-His tag HG18010-NH
TRIM21 cDNA ORF Clone, Human, C-HA tag HG18010-CY
TRIM21 cDNA ORF Clone, Human, N-HA tag HG18010-NY
TRIM21 cDNA ORF Clone, Human, C-Myc tag HG18010-CM
TRIM21 cDNA ORF Clone, Human, N-Myc tag HG18010-NM
info info
添加购物车成功! 添加购物车失败!