Pedido rápido

Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus UBA1 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005593407.1
Tamaño de cDNA:3177bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like modifier activating enzyme 1 with C terminal His tag.
Sinónimo de gen:UBA1
Especie:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90821-ACG$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90821-ACR$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90821-ANG$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90821-ANR$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90821-CF$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90821-CH$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90821-CM$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90821-CY$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(Vector de expresión)CG90821-G$75
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90821-NF$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90821-NH$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90821-NM$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90821-NY$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación)CG90821-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

Referencias
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catálogo: CG90821-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"