After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus UBA1 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005593407.1
Tamaño de cDNA:3177bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like modifier activating enzyme 1 with N terminal Myc tag.
Sinónimo de gen:UBA1
Especie:Cynomolgus
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90821-ACG$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90821-ACR$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90821-ANG$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90821-ANR$325
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90821-CF$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90821-CH$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90821-CM$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90821-CY$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(Vector de expresión)CG90821-G$75
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90821-NF$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90821-NH$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90821-NM$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90821-NY$295
Cangrejero UBE1 / UBA1 clonación del ADN o clonación génica(vector de clonación)CG90821-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

Referencias
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catálogo: CG90821-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"