Pedido rápido

Text Size:AAA

Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cangrejero UBL7 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005560073.1
Tamaño de cDNA:1143bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like 7 (bone marrow stromal cell-derived).
Sinónimo de gen:UBL7
Especie:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación) on other vectors
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90775-ACG$225
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90775-ACR$225
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90775-ANG$225
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90775-ANR$225
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90775-CF$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90775-CH$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90775-CM$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90775-CY$195
Cangrejero UBL7 clonación del ADN o clonación génica(Vector de expresión)CG90775-G$75
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90775-NF$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90775-NH$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90775-NM$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90775-NY$195
Cangrejero UBL7 clonación del ADN o clonación génica(vector de clonación)CG90775-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: CG90775-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"