After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus UCHL1 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_005554754.1
Tamaño de cDNA:672bp
Descripción de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase).
Sinónimo de gen:UCH-L1
Especie:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90725-ACG$225
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90725-ACR$225
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90725-ANG$225
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90725-ANR$225
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90725-CF$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90725-CH$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90725-CM$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90725-CY$195
Cangrejero UCHL1 clonación del ADN o clonación génica(Vector de expresión)CG90725-G$75
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90725-NF$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90725-NH$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90725-NM$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90725-NY$195
Cangrejero UCHL1 clonación del ADN o clonación génica(vector de clonación)CG90725-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

Referencias
  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
  • Size / Price
    Catálogo: CG90725-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"