After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Cynomolgus YWHAB Información de producto de clon de cDNA
Gene_bank_ref_id:XM_001109676.2
Tamaño de cDNA:735bp
Descripción de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide with N terminal Myc tag.
Sinónimo de gen:YWHAB
Especie:Rhesus
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaCG90022-ACG$225
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaCG90022-ACR$225
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaCG90022-ANG$225
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaCG90022-ANR$225
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaCG90022-CF$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaCG90022-CH$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaCG90022-CM$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaCG90022-CY$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(Vector de expresión)CG90022-G$75
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaCG90022-NF$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaCG90022-NH$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaCG90022-NM$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaCG90022-NY$195
Rhesus 14-3-3 beta/YWHAB clonación del ADN o clonación génica(vector de clonación)CG90022-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.

Referencias
  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.
  • Size / Price
    Catálogo: CG90022-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"