After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tag

Hoja de datosReseñasProductos relacionadosProtocolos
DENV DENV-NS4B Información de producto de clon de cDNA
Gene_bank_ref_id:AF038403.1
Tamaño de cDNA:744bp
Descripción de cDNA:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4B with C terminal HA tag.
Sinónimo de gen:DENV-NS4B
Especie:DENV
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6826..7569), corresponding to amino acid sequence AAC59275.1 (aa 2244-2491).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-GFPSpark tagVG40266-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40266-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-GFPSpark tagVG40266-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40266-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40266-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-His tagVG40266-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-Myc tagVG40266-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tagVG40266-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid (Codon Optimized)VG40266-G$95
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Flag tagVG40266-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-His tagVG40266-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Myc tagVG40266-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-HA tagVG40266-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS4B natural ORF mammalian expression plasmidVG40266-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40266-CY
Precio de lista:   (Save )
Precio:      [How to order]
Disponibilidad
 Instrucciones de envío
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"