Pedido rápido

Humano ELF5 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human ELF5 Información de producto de clon de cDNA
Tamaño de cDNA:768bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens E74-like factor 5 (ets domain transcription factor).
Sinónimo de gen:ESE2
Sitio de restricción:KpnI + XhoI (5.5kb + 0.77kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human ELF5 Gene Plasmid Map
Human ELF5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Humano ELF5 clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG12490-G-N
Precio de lista: 
Precio:      (You Save: )
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
  • Human ELF5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.