Pedido rápido

E. coli stx2B / Shiga toxin II subunit B clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    E. coli Shiga toxin II subunit B Información de producto de clon de cDNA
    Gene_bank_ref_id:
    Tamaño de cDNA:1281bp
    Descripción de cDNA:Full length Clone DNA of Escherichia coli O104:H4 STX2 gene for Shiga toxin 2 A subunit (stx2A) and Shiga toxin 2 B subunit (stx2B) with C terminal HA tag.
    Sinónimo de gen:
    Especie:E. coli
    Vector:pCMV3-C-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Immunochemical staining of mouse ENPEP in mouse kidney with rabbit polyclonal antibody (0.1 µg/mL, formalin-fixed paraffin embedded sections).
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Fondo

    E. Coli STX2B is a subunit of Stx2. Stx2, together with Stx1, formed a family of related toxins which are known as shiga toxins. Shiga toxins are mainly produced by the bacteria S. dysenteriae and the Shigatoxigenic group of Escherichia coli, which includes serotypes O157:H7, O104:H4, and other enterohemorrhagic E. coli (EHEC). A total of 3222 outbreak cases (including 39 deaths) have been reported in northern Germany in May through June 2011. The outbreak strain was typed as an enteroaggregative Shiga-toxin–producing E. coli O104:H4, producing extended-spectrum beta-lactamase. The toxin has two subunits—A and B. E. Coli STX2B is the B subunit. It is a pentamer that binds to specific glycolipids on the host cell, specifically globotriaosylceramide. Following this, the A subunit is internalised and cleaved into two parts. Stx2 has been found to be approximately 400 times more toxic (as quantified by LD50 in mice) than Stx-1. The Stx1 and Stx2 B subunits form a pentameric structure that binds to globotriaosylceramidereceptors on eukaryotic cells and promotes endocytosis

    Referencias
  • Obata F. et al. (2008) Shiga Toxin 2 Affects the Central Nervous System through Receptor Globotriaosylceramide Localized to Neurons. J Infect Dis. 198 (9): 1398-406.
  • Tironi-Farinati C. et al. (2010) Intracerebroventricular Shiga toxin 2 increases the expression of its receptor globotriaosylceramide and causes dendritic abnormalities. J Neuroimmunol. 222 (1-2): 48-61.
  • Asakura H. et al. (2001) Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals. Epidemiol Infect. 127 (1): 27-36.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"