Pedido rápido

Text Size:AAA

Humano FABP3/H-FABP clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human FABP3 Información de producto de clon de cDNA
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Human FABP3 Gene Plasmid Map
Human FABP3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Contact Us
  • Human FABP3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.