Pedido rápido

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse FOLR1 Información de producto de clon de cDNA
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Mouse FOLR1 Gene Plasmid Map
Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50573-ACG$225
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50573-ACR$225
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50573-CF$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50573-CH$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50573-CM$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50573-CY$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(Vector de expresión)MG50573-M$75
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50573-NF$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50573-NH$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50573-NM$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50573-NY$195
Ratón Folate Binding Proteína/FOLR1 clonación del ADN o clonación génica(vector de clonación)MG50573-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Contact Us
  • Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Artículos vistos recientemente
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.