Pedido rápido

Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret ATP6V1B2 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_004763332.1
Tamaño de cDNA:1536bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 with C terminal His tag.
Sinónimo de gen:ATP6V1B2
Especie:Ferret
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60147-ACG$245
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60147-ACR$245
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60147-ANG$245
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60147-ANR$245
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60147-CF$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60147-CH$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60147-CM$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60147-CY$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(Vector de expresión)FG60147-G$75
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60147-NF$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60147-NH$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60147-NM$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60147-NY$215
Hurón ATP6V1B2 clonación del ADN o clonación génica(vector de clonación)FG60147-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: FG60147-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"