Pedido rápido

Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret CA2 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_004766964.1
Tamaño de cDNA:783bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) carbonic anhydrase II with N terminal Flag tag.
Sinónimo de gen:CA2
Especie:Ferret
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60084-ACG$225
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60084-ACR$225
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60084-ANG$225
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60084-ANR$225
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60084-CF$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60084-CH$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60084-CM$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60084-CY$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(Vector de expresión)FG60084-G$75
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60084-NF$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60084-NH$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60084-NM$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60084-NY$195
Hurón Carbonic Anhydrase II clonación del ADN o clonación génica(vector de clonación)FG60084-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

Referencias
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catálogo: FG60084-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"