Pedido rápido

Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Hurón CAMK2G Información de producto de clon de cDNA
    Gene_bank_ref_id:XM_004769400.1
    Tamaño de cDNA:1488bp
    Descripción de cDNA:Full length Clone DNA of Mustela putorius furo calcium>calmodulin-dependent protein kinase II gamma with C terminal His tag.
    Sinónimo de gen:CAMK2G
    Especie:Ferret
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60160-ACG$225
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60160-ACR$225
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60160-ANG$225
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60160-ANR$225
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60160-CF$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60160-CH$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60160-CM$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60160-CY$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(Vector de expresión)FG60160-G$75
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60160-NF$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60160-NH$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60160-NM$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60160-NY$195
    Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación)FG60160-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: FG60160-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"