Pedido rápido

Text Size:AAA

Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret CAMK2G Información de producto de clon de cDNA
Tamaño de cDNA:1488bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo calcium>calmodulin-dependent protein kinase II gamma with C terminal His tag.
Sinónimo de gen:CAMK2G
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60160-ACG$225
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60160-ACR$225
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60160-ANG$225
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60160-ANR$225
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60160-CF$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60160-CH$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60160-CM$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60160-CY$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(Vector de expresión)FG60160-G$75
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60160-NF$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60160-NH$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60160-NM$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60160-NY$195
Hurón CaMKII/CAMK2G clonación del ADN o clonación génica(vector de clonación)FG60160-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: FG60160-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.