Pedido rápido

Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret CD3E Información de producto de clon de cDNA
Tamaño de cDNA:561bp
Descripción de cDNA:Full length Clone DNA of Ferret CD3 epsilon antigen with C terminal HA tag.
Sinónimo de gen:CD3
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60005-ACG$225
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60005-ACR$225
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60005-CF$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60005-CH$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60005-CM$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60005-CY$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(Vector de expresión)FG60005-G$75
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60005-G-H$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60005-NF$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60005-NH$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60005-NM$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60005-NY$195
Hurón CD3e/CD3 epsilon clonación del ADN o clonación génica(vector de clonación)FG60005-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • Size / Price
    Catálogo: FG60005-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.