HEBP1 cDNA ORF Clone, Ferret, C-Myc tag

Price:
Size:
Number:

HEBP1 cDNA ORF Clone, Ferret, C-Myc tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Ferret heme binding protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HEBP1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed