Pedido rápido

Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Hurón IFNG Información de producto de clon de cDNA
    Tamaño de cDNA:501bp
    Descripción de cDNA:Full length Clone DNA of Ferret Interferon gamma with N terminal HA tag.
    Sinónimo de gen:IFNG
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60007-ACG$225
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60007-ACR$225
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60007-CF$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60007-CH$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60007-CM$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60007-CY$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(Vector de expresión)FG60007-G$75
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60007-G-H$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60007-NF$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60007-NH$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60007-NM$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60007-NY$195
    Hurón Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación)FG60007-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catálogo: FG60007-NY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.