After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret METTL3 Información de producto de clon de cDNA
Tamaño de cDNA:1743bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) methyltransferase like 3 with C terminal HA tag.
Sinónimo de gen:METTL3
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60040-ACG$245
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60040-ACR$245
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60040-ANG$245
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60040-ANR$245
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60040-CF$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60040-CH$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60040-CM$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60040-CY$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(Vector de expresión)FG60040-G$75
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60040-NF$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60040-NH$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60040-NM$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60040-NY$215
Hurón METTL3/Methyltransferase like 3 clonación del ADN o clonación génica(vector de clonación)FG60040-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.