Pedido rápido

Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret MRPL39 Información de producto de clon de cDNA
Tamaño de cDNA:1008bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo mitochondrial ribosomal protein L39 with C terminal His tag.
Sinónimo de gen:MRPL39
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60159-ACG$225
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60159-ACR$225
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60159-ANG$225
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60159-ANR$225
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60159-CF$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60159-CH$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60159-CM$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60159-CY$195
Hurón MRPL39 clonación del ADN o clonación génica(Vector de expresión)FG60159-G$75
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60159-NF$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60159-NH$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60159-NM$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60159-NY$195
Hurón MRPL39 clonación del ADN o clonación génica(vector de clonación)FG60159-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: FG60159-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.