Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-Myc tag

Price:
Size:
Number:

Peroxiredoxin 2 cDNA ORF Clone, Ferret, N-Myc tag: General Information

Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Ferret peroxiredoxin 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Peroxiredoxin 2 Background Information

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to theahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains onethioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.
Full Name
peroxiredoxin 2
References
  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait