Pedido rápido

Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Hurón STX8 Información de producto de clon de cDNA
    Tamaño de cDNA:711bp
    Descripción de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) syntaxin 8 with C terminal Myc tag.
    Sinónimo de gen:STX8
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60077-ACG$225
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60077-ACR$225
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60077-ANG$225
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60077-ANR$225
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60077-CF$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60077-CH$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60077-CM$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60077-CY$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(Vector de expresión)FG60077-G$75
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60077-NF$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60077-NH$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60077-NM$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60077-NY$195
    Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación)FG60077-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Size / Price
    Catálogo: FG60077-CM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.