Pedido rápido

Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ferret STX8 Información de producto de clon de cDNA
Gene_bank_ref_id:XM_004760175.1
Tamaño de cDNA:711bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) syntaxin 8 with N terminal Flag tag.
Sinónimo de gen:STX8
Especie:Ferret
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaFG60077-ACG$225
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaFG60077-ACR$225
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaFG60077-ANG$225
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaFG60077-ANR$225
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaFG60077-CF$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaFG60077-CH$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaFG60077-CM$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaFG60077-CY$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(Vector de expresión)FG60077-G$75
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaFG60077-NF$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaFG60077-NH$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaFG60077-NM$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaFG60077-NY$195
Hurón STX8 / Syntaxin 8 clonación del ADN o clonación génica(vector de clonación)FG60077-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

Referencias
  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Size / Price
    Catálogo: FG60077-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"