Pedido rápido

Hurón CD90/THY-1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Hurón THY1 Información de producto de clon de cDNA
Tamaño de cDNA:486bp
Descripción de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) Thy-1 cell surface antigen with N terminal HA tag.
Sinónimo de gen:THY1
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Catálogo: FG60039-NY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.