Pedido rápido

Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

  • HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
Hoja de datosReseñasProductos relacionadosProtocolos
Humano ITGB1 Información de producto de clon de cDNA
Tamaño de cDNA:2397bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal Myc tag.
Sinónimo de gen:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
Sitio de restricción:KpnI + XbaI (6kb + 2.44kb)
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 459T/C not causing the amino acid variation.
( We provide with ITGB1 qPCR primers for gene expression analysis, HP100590 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano ITGB1 Gene Plasmid Map
HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10587-ACG$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10587-ACR$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10587-ANG$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10587-ANR$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10587-CF$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10587-CH$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10587-CM$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10587-CY$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(Vector de expresión)HG10587-M$75
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10587-NF$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10587-NH$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10587-NM$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10587-NY$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonación del ADN o clonación génica(vector de clonación)HG10587-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.