After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
HIV HIV-rev Información de producto de clon de cDNA
Gene_bank_ref_id:K03455
Tamaño de cDNA:351bp
Descripción de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with C terminal HA tag.
Sinónimo de gen:HIV-rev
Especie:HIV
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA Etiqueta on other vectors
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40247-ACG$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40247-ACR$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40247-ANG$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40247-ANR$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag EtiquetaVG40247-CF$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His EtiquetaVG40247-CH$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc EtiquetaVG40247-CM$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA EtiquetaVG40247-CY$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-G$95
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag EtiquetaVG40247-NF$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His EtiquetaVG40247-NH$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc EtiquetaVG40247-NM$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA EtiquetaVG40247-NY$295
HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40247-CY
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"