Pedido rápido

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
HIV HIV-rev Información de producto de clon de cDNA
Tamaño de cDNA:351bp
Descripción de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) rev with N terminal His tag.
Sinónimo de gen:HIV-rev
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His Etiqueta on other vectors
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40247-ACG$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40247-ACR$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40247-ANG$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40247-ANR$325
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Flag EtiquetaVG40247-CF$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-His EtiquetaVG40247-CH$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-Myc EtiquetaVG40247-CM$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, C-HA EtiquetaVG40247-CY$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid (Codon Optimized)VG40247-G$95
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Flag EtiquetaVG40247-NF$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-His EtiquetaVG40247-NH$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-Myc EtiquetaVG40247-NM$295
HIV-1 (group M, subtype B, strain HXB2) rev ORF mammalian expression plasmid, N-HA EtiquetaVG40247-NY$295
HIV-1 (group M, subtype B, strain HXB2) rev natural ORF mammalian expression plasmidVG40247-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40247-NH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.