After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
HIV HIV-tat Información de producto de clon de cDNA
Gene_bank_ref_id:K03455
Tamaño de cDNA:261bp
Descripción de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) tat with N terminal His tag.
Sinónimo de gen:HIV-tat
Especie:HIV
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His Etiqueta on other vectors
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40246-ACG$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40246-ACR$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40246-ANG$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40246-ANR$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-Flag EtiquetaVG40246-CF$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-His EtiquetaVG40246-CH$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-Myc EtiquetaVG40246-CM$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-HA EtiquetaVG40246-CY$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid (Codon Optimized)VG40246-G$95
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-Flag EtiquetaVG40246-NF$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His EtiquetaVG40246-NH$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-Myc EtiquetaVG40246-NM$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-HA EtiquetaVG40246-NY$295
HIV-1 (group M, subtype B, strain HXB2) tat natural ORF mammalian expression plasmidVG40246-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: VG40246-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"