Pedido rápido

HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    HIV HIV-gag Información de producto de clon de cDNA
    Gene_bank_ref_id:U52953.1
    Tamaño de cDNA:1491bp
    Descripción de cDNA:Full length Clone DNA of HIV-1 (group M, subtype C, strain 92BR025.8) gag with N terminal His tag.
    Sinónimo de gen:HIV-gag
    Especie:HIV
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His Etiqueta on other vectors
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40250-ACG$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40250-ACR$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40250-ANG$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40250-ANR$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Flag EtiquetaVG40250-CF$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-His EtiquetaVG40250-CH$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Myc EtiquetaVG40250-CM$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-HA EtiquetaVG40250-CY$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid (Codon Optimized)VG40250-G$95
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Flag EtiquetaVG40250-NF$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His EtiquetaVG40250-NH$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Myc EtiquetaVG40250-NM$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-HA EtiquetaVG40250-NY$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmidVG40250-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"