Pedido rápido

Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human HSPA8 Información de producto de clon de cDNA
Tamaño de cDNA:1941bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens heat shock 70kDa protein 8 with Flag tag.
Sinónimo de gen:LAP1, HSC54, HSC70, HSC71, HSP71, HSP73, NIP71, HSPA10, MGC29929, MGC131511, HSPA8
Sitio de restricción:KpnI + XhoI (5.5kb + 1.97kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPA8 Gene Plasmid Map
Human HSPA8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human HSPA8 Gene Expression validated Image
Human HSPA8 natural ORF mammalian expression plasmid, Flag tag
[Hacer clic para ampliar la imagen]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11329-ACG$245
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11329-ACR$245
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11329-ANG$245
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11329-ANR$245
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11329-CF$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11329-CH$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11329-CM$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11329-CY$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(Vector de expresión)HG11329-M$75
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11329-NF$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11329-NH$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11329-NM$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11329-NY$215
Humano HSPA8/HSC70 clonación del ADN o clonación génica(vector de clonación)HG11329-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.

  • Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.
  • Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.
  • Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.
  • Size / Price
    Catálogo: HG11329-M-F
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human HSPA8 natural ORF mammalian expression plasmid, Flag tag
    • Human HSPA8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.