Pedido rápido

Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human AACS Información de producto de clon de cDNA
Tamaño de cDNA:2019bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens acetoacetyl-CoA synthetase with C terminal His tag.
Sinónimo de gen:ACSF1, SUR-5, FLJ12389, FLJ41251, AACS
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11117-ACG$245
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11117-ACR$245
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11117-ANG$245
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11117-ANR$245
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11117-CF$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11117-CH$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11117-CM$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11117-CY$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(Vector de expresión)HG11117-M$75
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11117-NF$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11117-NH$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11117-NM$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11117-NY$215
Humano Acetoacetyl-CoA Synthetase clonación del ADN o clonación génica(vector de clonación)HG11117-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Acetoacetyl-CoA Synthetase (AACS) is a novel cytosolic ketone body (acetoacetate)-specific ligase. The AACS in adipose tissue plays an important role in utilizing ketone body for the fatty acid-synthesis during adipose tissue development. It had been improved that Acetoacetyl-CoA Synthetase is an essential enzyme for the synthesis of fatty acid and cholesterol from ketone bodies, was found to be highly expressed in mouse adipose tissue, and GC box and C/EBPs motif were crucial for AACS promoter activity in 3T3-L1 adipocytes. Moreover, AACS promoter activity was controlled mainly by C/EBPalpha during adipogenesis. AACS gene expression is particularly abundant in white adipose tissue, as it is induced during adipocyte differentiation. The human AACS promoter is a PPARgamma target gene and that this nuclear receptor is recruited to the AACS promoter by direct interaction with Sp1 (stimulating protein-1). The Acetoacetyl-CoA Synthetase has important roles in the regulation of ketone body utilization in rat liver and that these hypocholesterolemic agents have the ability to remedy the impaired utilization of ketone bodies under the diabetic condition.

  • Aguil F, et al. (2010) Transcriptional regulation of the human acetoacetyl-CoA synthetase gene by PPARgamma. Biochem J. 427(2): 255-64.
  • Hasegawa S, et al. (2008) Transcriptional regulation of ketone body-utilizing enzyme, acetoacetyl-CoA synthetase, by C/EBPalpha during adipocyte differentiation. Biochim Biophys Acta. 1779(6-7): 414-9.
  • Sato H, et al. (2002) Effects of streptozotocin-induced diabetes on acetoacetyl-CoA synthetase activity in rats. Biochem Pharmacol. 63(10): 1851-5.
  • Size / Price
    Catálogo: HG11117-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.