After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ABHD10 Información de producto de clon de cDNA
Gene_bank_ref_id:BC014516
Tamaño de cDNA:921bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens abhydrolase domain containing 10 with C terminal Flag tag.
Sinónimo de gen:ABHD10
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14439-ACG$225
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14439-ACR$225
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14439-ANG$225
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14439-ANR$225
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14439-CF$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14439-CH$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14439-CM$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14439-CY$195
Humano ABHD10 clonación del ADN o clonación génica(Vector de expresión)HG14439-G$75
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14439-NF$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14439-NH$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14439-NM$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14439-NY$195
Humano ABHD10 clonación del ADN o clonación génica(vector de clonación)HG14439-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.

Referencias
  • Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.
  • Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.
  • Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.
  • Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.
  • Size / Price
    Catálogo: HG14439-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"